View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19076_high_10 (Length: 220)

Name: NF19076_high_10
Description: NF19076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19076_high_10
NF19076_high_10
[»] chr2 (2 HSPs)
chr2 (19-102)||(32678511-32678593)
chr2 (25-71)||(12251644-12251690)
[»] chr5 (1 HSPs)
chr5 (109-153)||(40180104-40180149)


Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 32678511 - 32678593
Alignment:
19 ctcgagccatagattcaaatagaaatattaactatcatattgaatgaaaatgaatattgttcgccaagcatagactataaaaac 102  Q
    ||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
32678511 ctcgagccatagattcaaatagaaa-attaactattatattgaatgaaaatgactattgttcgccaagcatagactataaaaac 32678593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 71
Target Start/End: Complemental strand, 12251690 - 12251644
Alignment:
25 ccatagattcaaatagaaatattaactatcatattgaatgaaaatga 71  Q
    ||||||||||||||||||||| |||| || |||||||||||| ||||    
12251690 ccatagattcaaatagaaatagtaacaattatattgaatgaacatga 12251644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 40180149 - 40180104
Alignment:
109 aagatttttatgcagccaagc-gttgatctttaaaatgattgcaga 153  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||    
40180149 aagattttgatgcagccaagcagttgatctttaaaatgattgcaga 40180104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University