View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19076_low_9 (Length: 235)
Name: NF19076_low_9
Description: NF19076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19076_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 213
Target Start/End: Original strand, 7877455 - 7877545
Alignment:
| Q |
123 |
tagaattatgtgtgtatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgatgatcctgcttcacagaac |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7877455 |
tagaattatgtgcatatcacctctatctcatgaaattcgatcaataggttttgaagcatttcttaacgatgatgatcctgcttcactgaac |
7877545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 216
Target Start/End: Complemental strand, 7774172 - 7774079
Alignment:
| Q |
123 |
tagaattatgtgtgtatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgatgatcctgcttcacagaacctt |
216 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
7774172 |
tagaattatgtgcatatcatctctatctcatgaaattcgatctataggttttgaagcatttcttaacgatgatgatactgcttcagtgaacctt |
7774079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 208
Target Start/End: Original strand, 7908063 - 7908148
Alignment:
| Q |
123 |
tagaattatgtgtgtatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgatgatcctgcttcac |
208 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7908063 |
tagaattatgtttatatcaactctatctcatgaaactcgatctatagattttaaagcatttcttaacgatgatgatcctgcttcac |
7908148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 7771153 - 7771211
Alignment:
| Q |
137 |
tatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgat |
195 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7771153 |
tatcaactcaatctcatgaaattcgatctatagattttgaagcatttcttaacgatgat |
7771211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 7789838 - 7789896
Alignment:
| Q |
137 |
tatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgat |
195 |
Q |
| |
|
||||| ||| ||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7789838 |
tatcaactcaatctcatgaaatttgatctatagattttgaagcatttcttaacgatgat |
7789896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 7238049 - 7237975
Alignment:
| Q |
137 |
tatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatgatgatcctgcttcacagaacc |
214 |
Q |
| |
|
|||||||| |||||||||||||||||| || ||| |||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
7238049 |
tatcacctttatctcatgaaattcgatcaatcgatcctgaagcatttcttaacga---tgatcctggttcacagaacc |
7237975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 193
Target Start/End: Original strand, 7765376 - 7765426
Alignment:
| Q |
143 |
ctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatg |
193 |
Q |
| |
|
||||||||| ||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
7765376 |
ctctatctcctgaaattcgatcaattgattttgatgcatttcttaacgatg |
7765426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 193
Target Start/End: Original strand, 7786198 - 7786248
Alignment:
| Q |
143 |
ctctatctcatgaaattcgattcatagattttgaagcatttcttaacgatg |
193 |
Q |
| |
|
||||||||| ||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
7786198 |
ctctatctcctgaaattcgatcaattgattttgatgcatttcttaacgatg |
7786248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 188
Target Start/End: Original strand, 7904767 - 7904832
Alignment:
| Q |
123 |
tagaattatgtgtgtatcacctctatctcatgaaattcgattcatagattttgaagcatttcttaa |
188 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
7904767 |
tagaattatgtgcatatcatatctatctcatgaaattcaatctttatattttgaagcatttcttaa |
7904832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 11006275 - 11006233
Alignment:
| Q |
153 |
tgaaattcgattcatagattttgaagcatttcttaacgatgat |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
11006275 |
tgaaattcgatccatagattttgaagcatcgcttaacgatgat |
11006233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University