View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19078_high_4 (Length: 266)
Name: NF19078_high_4
Description: NF19078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19078_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 23965378 - 23965595
Alignment:
| Q |
13 |
aatatgaggatcagttgagtgaagcttcaaatgaggtttcatctgagagtgagtggaatcaggatttgtctgaggatcataatgatgatattcatgagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23965378 |
aatatgaggatcagttgagtgaagcttcaaatgaggtttcatctgagagtgagtggaatcaggatttgtctgaggatcataatgatgatattcatgagta |
23965477 |
T |
|
| Q |
113 |
tcagtggaatgtacgacacaatgagatctttgaacatgtttacagttgtttctctgtctcatctctgaatagggtatgtcaccttatgcatatctaa-tt |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23965478 |
tcagtggaatatacgacacaatgagatctttgaacatgtttacagttgtttctctgtctcatctctgaatagggtatgtcaccttatgcatatctaactt |
23965577 |
T |
|
| Q |
212 |
ctctaacccaatttcatt |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23965578 |
ctctaacccaatttcatt |
23965595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 129 - 225
Target Start/End: Original strand, 23989483 - 23989580
Alignment:
| Q |
129 |
cacaatgagatctttgaacatgtttacagttgtttctctgtctcatctctgaatagggtatgtcaccttatgcatatctaa-ttctctaacccaattt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||||| | ||| |||||||| |||||||||||||||| |
|
|
| T |
23989483 |
cacaatgagatctttgaacatgtttacagttgtttcccggtctcatctcttaaaagggtatgtcacatgatgtatatctaacttctctaacccaattt |
23989580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 225
Target Start/End: Original strand, 23982805 - 23982898
Alignment:
| Q |
133 |
atgagatctttgaacatgtttacagttgtttctctgtctcatctctgaatagggtatgtcaccttatgcatatctaa-ttctctaacccaattt |
225 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| | |||| ||||| || |||||||||||| | ||| |||||||| |||||||||||||||| |
|
|
| T |
23982805 |
atgagacctttgaacaattttacagttgtttaccaatctcgtctcttaaaagggtatgtcacatgatgtatatctaacttctctaacccaattt |
23982898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University