View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19078_high_5 (Length: 246)
Name: NF19078_high_5
Description: NF19078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19078_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 232
Target Start/End: Original strand, 51223897 - 51224119
Alignment:
| Q |
10 |
catcatcataaacaaatttcactgtcagtgtaaaaatatttttcacttgcatccaatcgcatcttatcattatgccaaacggttaatgttaattcctaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51223897 |
catcatcataaacaaatttcactgtcagtgtaaaaatatttttcacttgcatccaatcacatctcatcattatgccaaacggttaatgttaattcctaaa |
51223996 |
T |
|
| Q |
110 |
atatctccacaattatctatgtgttgagatgtgatttgatgcatgctttttacaaatacagtgcatagcagttattctcatattttcatgagaaaacatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51223997 |
atatctccacaattatctatgtgttgagatgggatttgatgcatactttttacaaatacagtgcatatcagttattctcatattttcatgagaaaacatt |
51224096 |
T |
|
| Q |
210 |
ttggaaactaaaaagagattttt |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51224097 |
ttggaaactaaaaagagattttt |
51224119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 5484970 - 5484917
Alignment:
| Q |
101 |
attcctaaaatatctccacaattatctatgtgttgagatgtgatttgatgcatg |
154 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||||||||| |||||||| |
|
|
| T |
5484970 |
attcctaaaatatctccacaaatatctaaaaggtgagatgtgattggatgcatg |
5484917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 143
Target Start/End: Complemental strand, 36224292 - 36224244
Alignment:
| Q |
95 |
atgttaattcctaaaatatctccacaattatctatgtgttgagatgtga |
143 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
36224292 |
atgttagttcctgaaatatctcctcaattatctatgtagtgagatgtga |
36224244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University