View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19079_high_2 (Length: 431)
Name: NF19079_high_2
Description: NF19079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19079_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 183 - 413
Target Start/End: Complemental strand, 1647415 - 1647185
Alignment:
| Q |
183 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647415 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
1647316 |
T |
 |
| Q |
283 |
cttcaattgtctttgaagcaccagcagttcttgcagtgatctcaagtctctttctagcaatggaggaggaacaacttttgttgtcacctaggaaggatcc |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
1647315 |
cttcaattgtctttgaagcaccagcagttcttgcagtgatctcaagtctctttctagcaatggaggaggaaccacttttgttgtcacctaggaacgatcc |
1647216 |
T |
 |
| Q |
383 |
tgaaacaccccttttggcttcatgaagtgag |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1647215 |
tgaaacaccccttttggcttcatgaagtgag |
1647185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 11 - 137
Target Start/End: Complemental strand, 1647553 - 1647417
Alignment:
| Q |
11 |
cacagacaaggatatcagacataggaaacaacactgaca----------aataatattttgagaacgtgaaatattggaatttaaccatatgtgtcggtg |
100 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1647553 |
cacagacaaggatattagacataggacacaacactgacacatcgacgcaaataatattttgagaacgtgaaatattggaatttaaccatatgtgtcagtg |
1647454 |
T |
 |
| Q |
101 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647453 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
1647417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University