View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_high_2 (Length: 478)
Name: NF1907_high_2
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 434; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 434; E-Value: 0
Query Start/End: Original strand, 14 - 463
Target Start/End: Complemental strand, 43325677 - 43325228
Alignment:
| Q |
14 |
gaaggcactaaaattatgattctagttataaaacttggtatgattatcctgttacagaaggctattatgtgtctttttcggtgtgaataaggcactaatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43325677 |
gaaggcactaaaattatgattctagttataaaacttggtatgattatcctgttacagaaggctattaagtgtctttttcggtgtgaataaggcactaatt |
43325578 |
T |
 |
| Q |
114 |
tctaattctagttatgtgtggttttagtaatgtctaatgtggtgttttatttatgtatttctgactttggggagcaatgtatcatataactatgatctgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325577 |
tctaattctagttatgtgtggttttagtaatgtctaatgtggtgttttatttatgtatttctgactttggggagcaatgtatcatataactatgatctgt |
43325478 |
T |
 |
| Q |
214 |
ggatctttgttggaaaaataaaagcactggtttgtattttcactatttctcttctttggcaatgtcaaaattttattatcttttgcatttggaaattggc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43325477 |
agatctttgttggaaaaataaaagcactggtttgtattttcactatttctcttctttggcaatgtcaaaattttattgtcttttgcatttggaaattggc |
43325378 |
T |
 |
| Q |
314 |
aagtacagcaaatagttgtaaccgttttgattggcactatgttattggttgaaaaatgtaagatataaaaataaaaactagtttggggttgttcatggcc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325377 |
aagtacagcaaatagttgtaaccgttttgattggcactatgttattggttgaaaaatgtaagctataaaaataaaaactagtttggggttgttcatggcc |
43325278 |
T |
 |
| Q |
414 |
cttttgagaaggggttattcatggaagccagatgctcatggtaacaaact |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325277 |
cttttgagaaggggttattcatggaagccagatgctcatggtaacaaact |
43325228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Complemental strand, 43325734 - 43325680
Alignment:
| Q |
46 |
acttggtatgattatcctgttacagaaggctattatgtgtctttttcggtgtgaa |
100 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
43325734 |
acttggtacgattatcctaatacagaaggctactatgtgtctttttcgatgtgaa |
43325680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University