View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_high_21 (Length: 270)
Name: NF1907_high_21
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 48175557 - 48175793
Alignment:
| Q |
17 |
tatctaaaatttataagatcaatcgcaattagatgaagctagtaatctgtggcattgtagatgagtttatttcatatcaactgcattgaatttcagaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48175557 |
tatctaaaatttataagatcaatcgcaattagatgaagctagtaatctgtggcattgtagatgagtttatttcatatcaactgcattgaatttcagaaaa |
48175656 |
T |
 |
| Q |
117 |
tggtttcaatagatcacatagaaatccctttaaataaaagatcacaccctttaggtatgaaaaaggagatagtagtgtaattgagaatttgagacctgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48175657 |
tggtttcaatagatcacatagaaatccctttaaataaaagatcacaccctttaggtatgaaaaaggagatagtagtgtaattgagaatttgagacctgtg |
48175756 |
T |
 |
| Q |
217 |
atagcgacaagaaacatgaatcatagttgttcattta |
253 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48175757 |
atagcgacaagaaacatgaatcaccgttgttcattta |
48175793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 85 - 151
Target Start/End: Original strand, 27335346 - 27335414
Alignment:
| Q |
85 |
atttcatatcaactgcattgaatttc--agaaaatggtttcaatagatcacatagaaatccctttaaat |
151 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||| ||| |||||||| | ||||||||||||| |
|
|
| T |
27335346 |
atttcatagcaactgaattgaatttgtgagaaaatggtttgaatggatcacattggaatccctttaaat |
27335414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 85 - 151
Target Start/End: Complemental strand, 48764795 - 48764727
Alignment:
| Q |
85 |
atttcatatcaactgcattgaatttc--agaaaatggtttcaatagatcacatagaaatccctttaaat |
151 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||| || ||||||||| || ||||||||||||||| |
|
|
| T |
48764795 |
attttatagcaactgcattgaatttgtgagaaaatggcttgaatagatcatatcgaaatccctttaaat |
48764727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University