View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_high_22 (Length: 270)
Name: NF1907_high_22
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 7 - 176
Target Start/End: Complemental strand, 8641439 - 8641270
Alignment:
| Q |
7 |
tccaagaatatatttcatcacaccttccctagagagagatccttcttggtcatggttccctaaaacagccacccaaggaatgtttgattcaattgcagga |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8641439 |
tccaacaatatatttcatcacaccttccctagagagtgatccttcttggtcatggttccctaaaacagccacccaaggaatgtttgattcaattgcagga |
8641340 |
T |
|
| Q |
107 |
gcaaatgcagcgtccatcgatttagccgaatccgaggaatcatgaccatagatgttatctcctgtcatac |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8641339 |
gcaaatgcagcgtccatcgatttagccgaatccgaggaatcatgaccatagatgttatctcctgtcatac |
8641270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 7 - 176
Target Start/End: Complemental strand, 8648019 - 8647850
Alignment:
| Q |
7 |
tccaagaatatatttcatcacaccttccctagagagagatccttcttggtcatggttccctaaaacagccacccaaggaatgtttgattcaattgcagga |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8648019 |
tccaacaatatatttcatcacaccttccctagagagtgatccttcttggtcatggttccctaaaacagccacccaaggaatgtttgattcaattgcagga |
8647920 |
T |
|
| Q |
107 |
gcaaatgcagcgtccatcgatttagccgaatccgaggaatcatgaccatagatgttatctcctgtcatac |
176 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
8647919 |
gcaaatgcagcgttcatcgatttagccgaatccgaggaatcatagccatagatattatctcctgtcatac |
8647850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University