View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_high_37 (Length: 231)
Name: NF1907_high_37
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 37632565 - 37632362
Alignment:
| Q |
14 |
attatacttacgtgtttttatgtgatttcgacgcaggagtgtgtcatttttgtttgatgtcttagtgctacattctttgnnnnnnngtcttgttacaatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37632565 |
attatacttacgtgtttttatgtgatttcgacgcaggagtgtgtcatttttgtttgatgtcttagtgctacattctttgttttttcgtcttgttacaatg |
37632466 |
T |
 |
| Q |
114 |
ttcgactcaatca-aannnnnnnnnnagaatcagctaatattattaacacaaaggtgtacaagacgcacaacaaactcggtggtagaaaaaataaagtgc |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37632465 |
ttcgactcaatcatttttttttttttggaatcagctaatattattaacacaatggtgtacaagacgcacaacaaactcggtgggagaaaaaataaagtgc |
37632366 |
T |
 |
| Q |
213 |
aaaa |
216 |
Q |
| |
|
|||| |
|
|
| T |
37632365 |
aaaa |
37632362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University