View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_low_25 (Length: 263)
Name: NF1907_low_25
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 34383755 - 34383524
Alignment:
| Q |
15 |
atcattcctcttttattattaatgatnnnnnnnn-ttgtactttgttaaatgacaaaactagccccttaagttggcaaagaagataatcgaatttgagac |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34383755 |
atcattcctcttttattattaatgataaaaaaaaattgtactttgttaaatgacaaaactagccccttaagttggcaaagaagataatcgaatttgagac |
34383656 |
T |
|
| Q |
114 |
tttcgagagaagcatactctaaggtttcatgccaacatctccggaccaacgttagtaacttttttcaatggtaaatgttaattgttaatttgttatatta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34383655 |
tttcgagagaagcatactctaaggtttcatgccaacatcttcggaccaacgttagtaacttttttcaatggtaaatgttaattgttaatttgttagatta |
34383556 |
T |
|
| Q |
214 |
gtttttacaccattaatactagagctaggagt |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
34383555 |
gtttttacaccattaaaactagagctaggagt |
34383524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 132
Target Start/End: Complemental strand, 6577150 - 6577114
Alignment:
| Q |
96 |
gataatcgaatttgagactttcgagagaagcatactc |
132 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
6577150 |
gataatcgaatttgagactttcgagaaaagcacactc |
6577114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University