View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_low_32 (Length: 250)
Name: NF1907_low_32
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 89 - 241
Target Start/End: Complemental strand, 5111864 - 5111712
Alignment:
| Q |
89 |
ggttcttggcaatgataaaggaggtcaaatttattttacaaatggtgtattattgatccaagtggattgtcttctaagaactttgcattttagtgggatt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5111864 |
ggttcttggcaatgataaaggaggtcaaatttattttacaaatggtgtattattgatccaagtggattgtcttctaagaactttgcattttagtgggatt |
5111765 |
T |
 |
| Q |
189 |
tgtaaggtttttattttctttattgacatatttatcttcagttttatattctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5111764 |
tgtaaggtttttattttctttattgacatatttatcttcagttttattttctt |
5111712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University