View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1907_low_33 (Length: 248)

Name: NF1907_low_33
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1907_low_33
NF1907_low_33
[»] chr1 (1 HSPs)
chr1 (154-234)||(48045788-48045868)


Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 154 - 234
Target Start/End: Original strand, 48045788 - 48045868
Alignment:
154 aagaagaaatatttgttttatattctcttacagtatttattaaaataaaaacagaggacgtacaataaacaagttcttact 234  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||    
48045788 aagaagaaatatttgttttatattctcttatagtatttattaaaataaaaacaggggacgtacaataaacaagttcttact 48045868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University