View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1907_low_42 (Length: 208)
Name: NF1907_low_42
Description: NF1907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1907_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 7226709 - 7226540
Alignment:
| Q |
20 |
ttacaagatagaattgtatatgttaatttgtttccttccaaaaaa-ttaatttacaagataagacttaatttgttgaccaaacaacataaacttcaaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7226709 |
ttacaagatagaattgtatatgttaatttgtttccttccaaaaaaattaatttacaagataagacttaatttgttgaccaaacaacataaacttcaaaag |
7226610 |
T |
|
| Q |
119 |
ttaatagtattattattaacattataaatttgttactatttgatattgatttttcactttaacagtttagga |
190 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7226609 |
ttaatagtattattattaaca--ctaaatttgttactatttgatattgatttttcactttaacactttagga |
7226540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University