View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19080_low_1 (Length: 451)
Name: NF19080_low_1
Description: NF19080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19080_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 99 - 444
Target Start/End: Original strand, 47084219 - 47084571
Alignment:
| Q |
99 |
tacatacagaatagatagattatggaattgactagacttttttaatataaataaaaattgaccagactttaaggtcttttagttttatcaaagatcgatg |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47084219 |
tacatgcagaatagatagattatggaattgactagacttttttaatataaataaaaattgaccagactttaaggtcttttagttttatcaaagatcgatg |
47084318 |
T |
 |
| Q |
199 |
ttgtgcctgtggtcattattagttatcagtctaatgtcaatgattttgtaatcaattttagaaatagattagtctaatagttcttccctaatatgttaag |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47084319 |
ttgtgcctgtggtcattattagttatcagtctaatgtcaatgattttgtaatcaattttagaaatagattagtctaatagttcttccctaatatgttaag |
47084418 |
T |
 |
| Q |
299 |
acttgttttgcaaaatggaaatttcagtattgtttgctcccgaaattgaaatgtttttggttagtgttcaacacgtcgtatgaccaacttttggtc---- |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
47084419 |
acttgttttgcaaaatggaaatttcagtattgtttgctcccgaaattgaaatgtttttggttagtgttcaacacgtcctatgactaacttttggtcatcc |
47084518 |
T |
 |
| Q |
395 |
---atcctaatgcccaactctagttcattttactttttactccgatatactcc |
444 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47084519 |
caaatcccaatgcccaactctagttcattttactttttactccgatatactcc |
47084571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University