View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19081_high_5 (Length: 302)
Name: NF19081_high_5
Description: NF19081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19081_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 13752487 - 13752672
Alignment:
| Q |
19 |
ggagcggctcaagtttagtggttgtaagaatttcaagggatggcagagaatggaaggtcaggtcagtgtagataaactctcgcagccgccattgggtcgt |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| | |
|
|
| T |
13752487 |
ggagcggctaaagtttagtggttgtaagaatttcaagggatggcagagaatggaaggtcaggtcagtgtagatatactctcgcggccgccattgggtcct |
13752586 |
T |
 |
| Q |
119 |
ctctctcaactaataatcaacaaatgcccaaagttgactgacttgcctacttttccaaatgttgaagaattgcagttgtgtgaatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13752587 |
ctctctcaactaataatcaacaaatgcccaaagttgactgacttgcctacttttccaaatgttgaagaattgcagttgtgtgaatc |
13752672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 6116085 - 6116270
Alignment:
| Q |
19 |
ggagcggctcaagtttagtggttgtaagaatttcaagggatggcagagaatggaaggtcaggtcagtgtagataaactctcgcagccgccattgggtcgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6116085 |
ggagcggctcaagtttagtggttgtaagaatttcacgggatggcagagaatgaaacgtcaggtcagtgtagataaactctcgcacccgccattgggtcgt |
6116184 |
T |
 |
| Q |
119 |
ctctctcaactaataatcaacaaatgcccaaagttgactgacttgcctacttttccaaatgttgaagaattgcagttgtgtgaatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6116185 |
ctctctcaactaataatcaacaaatgcccagagttgactgacttgcctacttttccaaatgttgaggaattgcagttgtgtgaatc |
6116270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 6123353 - 6123168
Alignment:
| Q |
19 |
ggagcggctcaagtttagtggttgtaagaatttcaagggatggcagagaatggaaggtcaggtcagtgtagataaactctcgcagccgccattgggtcgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||| |||||| | ||| |
|
|
| T |
6123353 |
ggagcggctcaagtttagtggttgtaagaatttcaagggatggaagagaacggaaggtcaggtcagtgtagataaacactcgcagcggccattcgtccgt |
6123254 |
T |
 |
| Q |
119 |
ctctctcaactaataatcaacaaatgcccaaagttgactgacttgcctacttttccaaatgttgaagaattgcagttgtgtgaatc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6123253 |
ctctctcaactaataatcaacaaatgcccaaagttgactgacttgcctacttttccaaatgttgaggaattgcagttgtgtgaatc |
6123168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 203 - 294
Target Start/End: Original strand, 13753143 - 13753234
Alignment:
| Q |
203 |
tcgtatgcgtttctactgctctcatattttcaaggattgtattgtttatgttgtgttgctttctttatgaatttaactgttgtttctttgca |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13753143 |
tcgtatgcgtttctactgctctcctattttcaaggattgtattgtttatgttgtgttgctttctttatgaatttaactgttgtttctttgca |
13753234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 260
Target Start/End: Original strand, 6117359 - 6117412
Alignment:
| Q |
207 |
atgcgtttctactgctctcatattttcaaggattgtattgtttatgttgtgttg |
260 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
6117359 |
atgcgtttctattgctctcatattttcagggattgtgtagtttatgttgtgttg |
6117412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University