View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19081_high_6 (Length: 238)
Name: NF19081_high_6
Description: NF19081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19081_high_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 238
Target Start/End: Complemental strand, 45694879 - 45694644
Alignment:
| Q |
3 |
agaacaaagatgcagctgcaataggaaggaatccttgcgaatcatcaaaagttgatttaagtggagaatgtccaaagagttcagccatacattgtcatca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694879 |
agaacaaagatgcagctgcaataggaaggaatccttgcgaatcatcaaaagttgatttaagtgtagaatgtccaaagagttcagccatacattgtcatca |
45694780 |
T |
|
| Q |
103 |
gtcagtagagccatccagggttggtttgaaacctttggagccgaaatctcttgagaaaaacactactgtttctacttctgcttgcaaagaagatgtatcc |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694779 |
gtcagtggagccatccagggttggtttgaaacctttggagccgaaatctcttgagaaaaacactactgtttctacttctgcttgcaaagaagatgtatcc |
45694680 |
T |
|
| Q |
203 |
aaagttgatcaaacttccaatcaagttcttagtgag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694679 |
aaagttgatcaaacttccaatcaagttcttagtgag |
45694644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 156
Target Start/End: Original strand, 37934621 - 37934670
Alignment:
| Q |
107 |
gtagagccatccagggttggtttgaaacctttggagccgaaatctcttga |
156 |
Q |
| |
|
||||||||||||| || || ||||||||||||| |||||||||| ||||| |
|
|
| T |
37934621 |
gtagagccatccaaggctgatttgaaacctttgcagccgaaatcgcttga |
37934670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University