View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19081_low_10 (Length: 238)
Name: NF19081_low_10
Description: NF19081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19081_low_10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 39 - 238
Target Start/End: Complemental strand, 33489276 - 33489077
Alignment:
| Q |
39 |
gattgctaaattggttgagcaaatagaaaccacggtctctaaacatggttttgagtttccatgtattcctagacaatacaagtggcaacaacacgcatag |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489276 |
gattgctaaattggttgagcaaatagaaaccacggtctctaaacatggttttgagtttccatgtattcctagacaatacaagtggcaacaacacgcatag |
33489177 |
T |
|
| Q |
139 |
aaaaaatcagcggtgccgctacaataaacaatagaaaccaaaccactgattttgttttaccgttaaaacaaaaacagctgtttcagctaacagaaaacac |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33489176 |
aaaaaatcatcggtgccgctacaataaacaatagaaaccaaaccactgattttgttataccgttaaaacaaaaactgctgtttcagctaacagaaaacac |
33489077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 142
Target Start/End: Complemental strand, 44679658 - 44679602
Alignment:
| Q |
84 |
tggttttgagtttccatgtattcctagacaatacaagtggcaacaacacgcatagaaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
44679658 |
tggttttgagtttccatgtattcctagacaatac--gtggcaacaacacgcatataaaa |
44679602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University