View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19081_low_8 (Length: 241)
Name: NF19081_low_8
Description: NF19081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19081_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 25011193 - 25010967
Alignment:
| Q |
1 |
aatttgtttttaaactgaaactcaccgcacctctctaaggatacttaaaaatgagcagacagaagtttacgctgttaccatttttgctttttactagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011193 |
aatttgtttttaaactgaaactcaccgcacctctctaaggatacttaaaaatgagcagacagaagtttacgctgttaccatttttgctttttactagaca |
25011094 |
T |
 |
| Q |
101 |
agtctgtttattctgcaactgactagatgatatttcatttgaatttggctcctttgtaggcgttggaaagatgtgagtattggcgcttgtcggatcagca |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011093 |
agtctgtttattttgcaactgactagatgacatttcatttgaatttggctcctttgtaggcgttggaaagatgtgagtattggcgcttgtcggatcagca |
25010994 |
T |
 |
| Q |
201 |
gggaaaaccccctggcgttatgggatg |
227 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
25010993 |
gggaaaaccccctggtgttatgggatg |
25010967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University