View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19083_high_23 (Length: 250)
Name: NF19083_high_23
Description: NF19083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19083_high_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 23423183 - 23422951
Alignment:
| Q |
18 |
gtgtttcatttctcgtgtataannnnnnnctttcaaatagtattgggagatctatattactagagatcatacatgtggagatggagcattaatttattga |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23423183 |
gtgtttcatttctcgtgtataatttttttctttcaaatagtattgggagatctatattactagagatcatacatgtggagatggagcattaatttattga |
23423084 |
T |
 |
| Q |
118 |
tcatagaataaagaaagtttagagatgctatattgccgtccaacgaaacatattcttagtacattataagactgacctgttttgccgtcctaaaataatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23423083 |
tcatagaataaagaaagtttagagatgctatattgccgtccaacgaaacatattcttagtacattataagactgacctgttttgccgtcctaaaataatt |
23422984 |
T |
 |
| Q |
218 |
tcatagagatttcactaatttttgttttggctt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23422983 |
tcatagagatttcactaatttttgttttggctt |
23422951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University