View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19083_high_25 (Length: 243)
Name: NF19083_high_25
Description: NF19083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19083_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 21875626 - 21875402
Alignment:
| Q |
1 |
agaacatagatagtacgttaagaatgggaatgatgagcttgatggttgcacttaacttgatgcaatctgatgcagataaaaatttggctcatgatcatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21875626 |
agaacatagatagtacgttaagaatgggaatgatgagcttgatggttgcacttaacttgatgcaatctgatgcggataaaaatttggctcatgatcatgc |
21875527 |
T |
|
| Q |
101 |
acaagttgtgcctatgacactctttgtagctgttctttgcctatgtttggtcattggtcatttgcttgaagaaagtcgatggattaatgaatccattgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21875526 |
acaagttgtgcctatgacactctttgtagctgttctttgcttatgtttggtcattggtcatttgcttgaagaaagtcgatggattaatgaatccattgtc |
21875427 |
T |
|
| Q |
201 |
gccatttttgttgtaagacacaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21875426 |
gccatttttgttgtaagacacaaat |
21875402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University