View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19083_low_11 (Length: 424)
Name: NF19083_low_11
Description: NF19083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19083_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 43 - 238
Target Start/End: Complemental strand, 16600214 - 16600015
Alignment:
| Q |
43 |
aaggatattatacatgtcttagaacacacaacaattgtttatttatttttcgcgaagaaaagagggaaacttgcaatgatattttagggatgggaaattc |
142 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16600214 |
aaggatattatagatgtcttagaacacacaacaattgtttatttatttttcgctaagaaaagagggaaacttgcaatgatattttagagatgggaaattc |
16600115 |
T |
|
| Q |
143 |
t-aaagaacaca---gagacaatcaaagagcaattcacctctataacaaatattgagaaaacaagaaaaattgaaaaaatccaaacgccatcacaaacct |
238 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16600114 |
taaaagaacacacccgagacaatcaaagagcaattcacctctataacaaatattgagaaaacaagaaaaattgaaaaaatccaaacgccatcacaaacct |
16600015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 232 - 370
Target Start/End: Complemental strand, 16599887 - 16599749
Alignment:
| Q |
232 |
caaacctctgcctcagacaaaataaattgtatgaagaatctaaatgtagtttaaattttaaaaaataaaatctagatttatgattgttataaatcagtat |
331 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
16599887 |
caaaactctgcctcagacaaaataaattgtatgaagaagataaatttagtttaatttttaaaaaataaaatcttgatttatgattgttataaattagtat |
16599788 |
T |
|
| Q |
332 |
ttttatttcatataaaatgcgcatcaatacatttatcaa |
370 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
16599787 |
ttttatttcatataaaatgcacatcactagatttatcaa |
16599749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University