View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19083_low_15 (Length: 375)
Name: NF19083_low_15
Description: NF19083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19083_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 92 - 361
Target Start/End: Original strand, 9950417 - 9950686
Alignment:
| Q |
92 |
gctagaaattttcaaatcactagaaaactgggcttctgagtctgttttaccactactaaagcctgtggaacaatgctggcagccacagagttttctccct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9950417 |
gctagaaattttcaaatcactagaaaactgggcttctgagtctgttttaccactactaaagcctgtggaacaatgctggcagccacagagttttctccct |
9950516 |
T |
|
| Q |
192 |
gatccttcattgccatttgatgaatttactgatcaggtgaaggtccttcgtgatcgcacgaaggaccttcctgatgagtattttgttgtgttggttggtg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9950517 |
gatccttcattgccatttgatgaatttactgatcaggtgaaggtccttcgtgatcgcacgaaggaccttcctgatgagtattttgttgtgttggttggtg |
9950616 |
T |
|
| Q |
292 |
atatggtgacggaagaggcacttccgacgtatcagagcatgattaatggtcttgatggtgttggtgatga |
361 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9950617 |
atatggtgacggaagatgcactaccgacgtatcagagcatgattaatggtcttgatggtgttggtgatga |
9950686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University