View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19083_low_23 (Length: 261)
Name: NF19083_low_23
Description: NF19083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19083_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 41249874 - 41250110
Alignment:
| Q |
1 |
acaaatcacccctgtatcgattcatctttaaactcatcaaaatttgaaaatgtactcataatttttgtgggacatcaatcatcacaatatcacatccagc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249874 |
acaaatcccccctgtatcgattcatctttaaactcatcaaaatttgaaaatatactcataatttttgtgggacatcaatcatcacaatatcacatccagc |
41249973 |
T |
|
| Q |
101 |
cagctgaaaataaagtaccaaatctgtgctgataactaccagtggcagaataaataaataccagtctcataaaattcatctcaaataatacaaaacattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41249974 |
cagctgaaaataaagtaccaaatctgtgctgataactaccagtggcagaataaataaataccagtctcataaaattcatct---------caaaacattt |
41250064 |
T |
|
| Q |
201 |
gatcatgtctttccaatgtctttaatttcttctcttcagaactaact |
247 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41250065 |
gatcatgtctttcc-atgtctttaatttcttctcttcagaactaact |
41250110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University