View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_36 (Length: 300)
Name: NF19084_high_36
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 82 - 295
Target Start/End: Complemental strand, 38320497 - 38320283
Alignment:
| Q |
82 |
cctctaagcgcttcactatttgtttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggatacaatgaaatatcttgtcaattgttttt |
181 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||| |
|
|
| T |
38320497 |
cctctaagcgcttcactatttgcttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggacacaatgaaatatcttgtgaagtgttttt |
38320398 |
T |
 |
| Q |
182 |
-aaaggctggccatgtaccaatggaatggagacaaagacttttaaaccaggccataattatcttctagatagtgagcataaacaattggcattttactag |
280 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38320397 |
taaaggctggccatgtatcaatggaatggagacaaagacttttaaaccagaccataattctcttcttgatagtgagcataaacaattggcattttactag |
38320298 |
T |
 |
| Q |
281 |
tctagaataatttac |
295 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
38320297 |
tctagaaaaatttac |
38320283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University