View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_40 (Length: 283)
Name: NF19084_high_40
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 53704660 - 53704397
Alignment:
| Q |
1 |
ccaaaaagaatgattactatttttgggaagatgttgtgtattacaatggattgttttatgctgtcagcaaaggaggaacaattgctgtgtgcgatgttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704660 |
ccaaaaagaatgattactatttttgggaagatgttgtgtattacaatggattgttttatgctgtcagcaaaggaggaacaattgctgtgtgcgatgttaa |
53704561 |
T |
 |
| Q |
101 |
tagtcatcgagtttccatttttcagatgacggtgcctgttcaattctccggggatattcactatgtggtgttctctggtgaggatatgttgttggtaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704560 |
tagtcatcgagtttccatttttcagatgacggtgcctgttcaattctccggggatattcactatgtggtgttctctggtgaggatatgttgttggtaaat |
53704461 |
T |
 |
| Q |
201 |
cggattttggaagaggatttttcggatgaacccaattatgatatgcttgtgtataggacggtgg |
264 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704460 |
cgggttttggaagaggatttttcggatgaacccaattatgatatgcttgtgtataggacggtgg |
53704397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University