View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_45 (Length: 273)
Name: NF19084_high_45
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 32645460 - 32645201
Alignment:
| Q |
1 |
ctgtgtggctttatcttctttctacattttgcaggtaaactaacgacccagtagttcgaccaataatttactgacctagtacttgatcgagcagaccaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32645460 |
ctgtgtggctttatcttctttctacattttgcaggtaaactaacgacccagtagttcgaccaatgatttactgacctagtacttgatcgagcagaccaag |
32645361 |
T |
 |
| Q |
101 |
gatccaattcttaaaacacttaactaattaattaaagtatacgaccatgatgtttggtgtcatatgtggattattatttctaaattgtttgtgggaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32645360 |
gatccaattcttaaaacacttaactaattaattaaagtatacgaccatgatgtttggtgtcatatgtggattattatttctaaattgtttgttggaattt |
32645261 |
T |
 |
| Q |
201 |
taatgcagtcgataacggtaaaaagatatccagctgagctctcattggcaaccttgatat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32645260 |
taatgcagtcgataacggtaaaaagatatccagctgagctatcattggcaaccttgatat |
32645201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University