View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_56 (Length: 246)
Name: NF19084_high_56
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36464991 - 36464776
Alignment:
| Q |
1 |
cttttctgttgtatgtgatattgaaactgttgctgatgtgtatatatataaggtttttgaaattaatagtgtctttgaaattatgtgtagaatttcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36464991 |
cttttctgttgtatgtgatattgaaactgttgctgatgtgtatatatataaggtttttgaaatt------------------atgtgtagaatttaatta |
36464910 |
T |
 |
| Q |
101 |
tgataaggtttatgatcaaggagttgttaagaactcacttgctccacctagtaccaaaaacattctta--tgattctgttaggttcctactaccaccaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36464909 |
tgataaggtttatgatcaaggagttgttaagaactcacttgctccacctagtaccaaaaacattcttatgtgattctgttaggttcctactaccaccaaa |
36464810 |
T |
 |
| Q |
199 |
atgac-aaaaaacaactaactaaaccaatgaatg |
231 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
36464809 |
atgacaaaaaaacaactaactaaaccaatgaatg |
36464776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University