View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_58 (Length: 241)
Name: NF19084_high_58
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 29093351 - 29093135
Alignment:
| Q |
17 |
agaggatggaaaggacgatagttggctcctatatccgtttttgaaa---tatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29093351 |
agaggatggaaaggacgatagttggctcctatatccgtttttgaaaccatatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg |
29093252 |
T |
|
| Q |
114 |
ttttttgtggcgatggcttgcagaactgaactcatttgatggaaacc----cac--ct-ttattattaagtcattgttttgtgcattgcagctggttaca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29093251 |
ttttttgtggcgatggcttgcagaactgaactcatttgatggaaaccatatcactactcttattattaagtcattattttgtgcattgcagctggttaca |
29093152 |
T |
|
| Q |
207 |
tcaccgtgatctcataa |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29093151 |
tcaccgtgatctcataa |
29093135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University