View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_60 (Length: 238)
Name: NF19084_high_60
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 7743068 - 7742956
Alignment:
| Q |
1 |
ctaacagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgtatccttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7743068 |
ctaacagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgtatccttcttt |
7742969 |
T |
 |
| Q |
101 |
ccatctcttcaag |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7742968 |
ccatctcttcaag |
7742956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 7742727 - 7742615
Alignment:
| Q |
106 |
tcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgtgctctccctctattagtattatcatcttcgtcttgcacatcaggaccga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7742727 |
tcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgcgctctccctctattagtattatcatcttcgtcttgcacatc---accga |
7742631 |
T |
 |
| Q |
206 |
taatgaagcctgcatg |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7742630 |
taatgaagcctgcatg |
7742615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 40864605 - 40864398
Alignment:
| Q |
4 |
acagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgtatccttctttcca |
103 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
40864605 |
acagatggcaaaagtgcttgctgttctacatctgtagtttcttcatcgtattct---gccaaccgctgctttccatatctctcttgtatccttcttgcca |
40864509 |
T |
 |
| Q |
104 |
tctcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgtgctctccctctattagtattatcatcttcgtcttgcacatcaggacc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| || |||| ||| || |||| |||||||||||||||||||||||||||| || |
|
|
| T |
40864508 |
tctcttcaaggtcttcatgatcttcttggtggggtggc---tgtctgtgacgtggccttcctc------tattatcatcttcgtcttgcacatcaggccc |
40864418 |
T |
 |
| Q |
204 |
gataatgaagcctgcatgtg |
223 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
40864417 |
aacaatgaagcctgcatgtg |
40864398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University