View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_67 (Length: 223)
Name: NF19084_high_67
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 37498097 - 37498286
Alignment:
| Q |
19 |
attttaccccttttgtgttaactgtgttcttgaattttttgcaggcttaagttttactgaagctgagaggaggctgcgggaaaatggtccaaatgttcca |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498097 |
attttcccccttttgtgttaactgtgttcttgaattttttgcaggcttaagttttactgaagctgagaggaggctgcgggaaaatggtccaaatgttcca |
37498196 |
T |
|
| Q |
119 |
cttgagtattcatttccaagctggtggaatcttctatggaatgctcttttccatcctttcaatatgattctgattattttatcttctctg |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498197 |
cttgagtattcatttccaagcttgtggaatcttctatggaatgctcttttccatcctttcaatatgattctgattattttatcttctctg |
37498286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University