View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_72 (Length: 216)
Name: NF19084_high_72
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 52624117 - 52624249
Alignment:
| Q |
18 |
aaaacaaggtgcaatcataggtttactcaccaatttctgcttcttcacctttgttgcacccattccaagaccgagacatagacctgtattgcattcttca |
117 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52624117 |
aaaacaaggtgcaatcacaggtttattcaccaatttctgcttcttcaccttcgttgcacccattccaagaccgagacatagacctgtattgcattcgtca |
52624216 |
T |
 |
| Q |
118 |
tcactttccatggctacaatagttagttggttg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52624217 |
tcactttccatggctacaatagttagttggttg |
52624249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 40039436 - 40039309
Alignment:
| Q |
19 |
aaacaaggtgcaatcataggtttactcaccaatttctgcttcttcacctttgttgcacccattccaagaccgagacatagacctgtattgcattcttcat |
118 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40039436 |
aaacaaggtgcaatcacaggtttattcactaatttctgcttcttctcctttgttgcacccattccaagaccgagacatagacctgtattgcattcttcat |
40039337 |
T |
 |
| Q |
119 |
cactttccatggctacaatagttagttg |
146 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
40039336 |
cactttccatggctacaatagttggttg |
40039309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University