View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_high_75 (Length: 203)
Name: NF19084_high_75
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_high_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 51 - 191
Target Start/End: Original strand, 52179870 - 52180010
Alignment:
| Q |
51 |
ccatattcttttacatctccatcacggtaactatccacgtcatccttaaactatgtcggagactgcgccctgtacctttaggtccattcccagcaattca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52179870 |
ccatattcttttacatctccatcacggtaactatccacgtcatccttaaactatgtcggagactgcgccctgtacctttaggtccattaccagcaattca |
52179969 |
T |
 |
| Q |
151 |
taatctctccatgtcattgatctccctaacaatattcttcg |
191 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
52179970 |
tagtctctccatgtcattaatctccctaacaatatttttcg |
52180010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University