View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_24 (Length: 356)
Name: NF19084_low_24
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 83 - 346
Target Start/End: Original strand, 44265570 - 44265818
Alignment:
| Q |
83 |
actacgaagtttttcgattatcttgaaggcctctttcctaagactcaagtttggtgatgcatctttctcacttggctcacatgctgatccatccaataat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44265570 |
actacgaagtttttcgattatcttgaaggcctctttcctaagactcaagtttggtggtgcatctttctcacttggctcacttgctgatccatccaataat |
44265669 |
T |
|
| Q |
183 |
actgatccatcacaaccctgcattttcannnnnnnaatccataaataaccaaatataataagtttggatttccaaagttagctaaacagattcatgctaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44265670 |
actgatccatcacaaccctgcattttcatttttttaatccataaataaccaaatataataagtttggatttccaaagtta---------------gctaa |
44265754 |
T |
|
| Q |
283 |
tttaatcaccacatatgctaattacaagcattgtaatgcttaattagtattgtttatagtataa |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265755 |
tttaatcaccacatatgctaattacaagcattgtaatgcttaattagtattgtttatagtataa |
44265818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University