View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_39 (Length: 291)
Name: NF19084_low_39
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 164 - 268
Target Start/End: Original strand, 20171686 - 20171790
Alignment:
| Q |
164 |
cagtgccttgaacaatttcggattatataatccaaaacattcctcgcgctacataaagtacgaagtttaatattatataatctgaaaagtttcgataggg |
263 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
20171686 |
cagtgccctgaacaatttcggattatataatccgaaacatccctcgcgctacataaagtacgaagtttcagattatataatctgaaaagtttcgataggg |
20171785 |
T |
 |
| Q |
264 |
tttca |
268 |
Q |
| |
|
||||| |
|
|
| T |
20171786 |
tttca |
20171790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University