View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_48 (Length: 267)
Name: NF19084_low_48
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 109 - 254
Target Start/End: Original strand, 21732894 - 21733038
Alignment:
| Q |
109 |
ccgattgtattttctagatagaaatatactcacttctttctataggtttttctcagtgtgaaagtaaacattccataaactaattatttcctttaaccgt |
208 |
Q |
| |
|
||||||||||||| |||| || || |||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
21732894 |
ccgattgtatttt-tagagaggaacatactcacttctttctataggtttatctcattgtgaaagtaaacattccattaactaattatttcctttaaacgt |
21732992 |
T |
 |
| Q |
209 |
tattgaaaattataccgttaatcttagtttatgtcacattgtttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21732993 |
tattgaaaattataccgttaatcttagtttatgtcacattgtttgt |
21733038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 109 - 239
Target Start/End: Original strand, 21741391 - 21741520
Alignment:
| Q |
109 |
ccgattgtattttctagatagaaatatactcacttctttctataggtttttctcagtgtgaaagtaaacattccataaactaattatttcctttaaccgt |
208 |
Q |
| |
|
||||||||||||| |||| || || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21741391 |
ccgattgtatttt-tagagaggaacatactcacttctttctataggtttttcacagtgtgaaagtaaacattccataaactaattatttcctttaaacgt |
21741489 |
T |
 |
| Q |
209 |
tattgaaaattataccgttaatcttagttta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21741490 |
tattgaaaattataccgttaatcttagttta |
21741520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University