View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_54 (Length: 250)
Name: NF19084_low_54
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_54 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 36465256 - 36465021
Alignment:
| Q |
15 |
ggcaccaagcctcaaaataaagtctaagattgcaattccctttttcattccacctttttgtagtgaagtagcttttgtggtaacaacagttgcagcatgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36465256 |
ggcaccaagcctcaaaataaagtctaagattgcaattccctttttcattccacctttttgtagtggagtagcttttgtggtaacaacagttgcagcatgt |
36465157 |
T |
 |
| Q |
115 |
ggaggagaacgatctccatcaatggatttcccttttccattgcttcttgtccttttggattctaggatgggagctgttgatgattcctcaacttctcttc |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465156 |
ggaggagaatgatctccatcaatggatttcccttttccattgcttcttgtccttttggattctaggatgggagctgttgatgattcctcaacttctcttc |
36465057 |
T |
 |
| Q |
215 |
ttgaatccatttgaatcaaattttataaatgctctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465056 |
ttgaatccatttgaatcaaattttataaatgctctc |
36465021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University