View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19084_low_60 (Length: 241)

Name: NF19084_low_60
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19084_low_60
NF19084_low_60
[»] chr4 (1 HSPs)
chr4 (17-223)||(29093135-29093351)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 29093351 - 29093135
Alignment:
17 agaggatggaaaggacgatagttggctcctatatccgtttttgaaa---tatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||    
29093351 agaggatggaaaggacgatagttggctcctatatccgtttttgaaaccatatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg 29093252  T
114 ttttttgtggcgatggcttgcagaactgaactcatttgatggaaacc----cac--ct-ttattattaagtcattgttttgtgcattgcagctggttaca 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    |||  || |||||||||||||||| ||||||||||||||||||||||||    
29093251 ttttttgtggcgatggcttgcagaactgaactcatttgatggaaaccatatcactactcttattattaagtcattattttgtgcattgcagctggttaca 29093152  T
207 tcaccgtgatctcataa 223  Q
    |||||||||||||||||    
29093151 tcaccgtgatctcataa 29093135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University