View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19084_low_61 (Length: 238)

Name: NF19084_low_61
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19084_low_61
NF19084_low_61
[»] chr5 (1 HSPs)
chr5 (100-223)||(35951483-35951606)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 100 - 223
Target Start/End: Original strand, 35951483 - 35951606
Alignment:
100 ttgatcaaacaccgggaatttcactcactctttcataaagttgaatcacactctgatatcagtctagaacaccgaattaaattgttacattgatctaaaa 199  Q
    |||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||  ||||    
35951483 ttgatcaaacactgggaattgcactcactctttcgtaaagttgaatcacactctgatatcggtctagaacaccgaagtaaattgttacattgataaaaaa 35951582  T
200 acaacgacaaatgtgagtttatac 223  Q
    ||||||||||||||||||||||||    
35951583 acaacgacaaatgtgagtttatac 35951606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University