View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_61 (Length: 238)
Name: NF19084_low_61
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 100 - 223
Target Start/End: Original strand, 35951483 - 35951606
Alignment:
| Q |
100 |
ttgatcaaacaccgggaatttcactcactctttcataaagttgaatcacactctgatatcagtctagaacaccgaattaaattgttacattgatctaaaa |
199 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35951483 |
ttgatcaaacactgggaattgcactcactctttcgtaaagttgaatcacactctgatatcggtctagaacaccgaagtaaattgttacattgataaaaaa |
35951582 |
T |
 |
| Q |
200 |
acaacgacaaatgtgagtttatac |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35951583 |
acaacgacaaatgtgagtttatac |
35951606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University