View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_66 (Length: 236)
Name: NF19084_low_66
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 131 - 213
Target Start/End: Complemental strand, 37658415 - 37658333
Alignment:
| Q |
131 |
atagaaaatactgtgttcagtgtaaataaactttgaaaagtatgtatatttcattgaccgatatagcagaatcagaatcaaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658415 |
atagaaaatactgtgttcagtgtaaataaactttgaaaagtatgtatatttcattgaccgatatagcagaatcagaatcaaca |
37658333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 37658545 - 37658485
Alignment:
| Q |
1 |
atatatttccagctccaagtaacattttgttgctctttaattgccatttaccagggaaaaa |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
37658545 |
atatatttccagctccaagtaacattttgtagctctttaattgctatttaccagggaaaaa |
37658485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University