View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19084_low_68 (Length: 227)

Name: NF19084_low_68
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19084_low_68
NF19084_low_68
[»] chr4 (1 HSPs)
chr4 (12-216)||(4753690-4753895)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 4753895 - 4753690
Alignment:
12 ttcatgataaattaacaaaataggtatgataaacctcttcactcagaaccctcttctccaattacaacctcataatctcatatgtgagttcgaaggcaat 111  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  |    
4753895 ttcacgataaattaataaaataggtatgataaacctcttcactcagaaccctcttctccgattacaacctcataatctcatatgtgagttcgaaggcttt 4753796  T
112 tcaatgataattttcaaatcacagtttagcaatccaatatttctatagtgaccgttaggttg-ataatattattagatcaaattcaacagttaatgctag 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||    
4753795 tcaatgataattttcaaatcacagtttagcaatccaatatttctatagtgaccgttaggttgaataatattattagatcaaattcaacacttaatgctag 4753696  T
211 taatca 216  Q
    ||||||    
4753695 taatca 4753690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University