View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_68 (Length: 227)
Name: NF19084_low_68
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 4753895 - 4753690
Alignment:
| Q |
12 |
ttcatgataaattaacaaaataggtatgataaacctcttcactcagaaccctcttctccaattacaacctcataatctcatatgtgagttcgaaggcaat |
111 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4753895 |
ttcacgataaattaataaaataggtatgataaacctcttcactcagaaccctcttctccgattacaacctcataatctcatatgtgagttcgaaggcttt |
4753796 |
T |
 |
| Q |
112 |
tcaatgataattttcaaatcacagtttagcaatccaatatttctatagtgaccgttaggttg-ataatattattagatcaaattcaacagttaatgctag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4753795 |
tcaatgataattttcaaatcacagtttagcaatccaatatttctatagtgaccgttaggttgaataatattattagatcaaattcaacacttaatgctag |
4753696 |
T |
 |
| Q |
211 |
taatca |
216 |
Q |
| |
|
|||||| |
|
|
| T |
4753695 |
taatca |
4753690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University