View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19084_low_70 (Length: 223)
Name: NF19084_low_70
Description: NF19084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19084_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 18930413 - 18930600
Alignment:
| Q |
17 |
tcatagtcttcataccgaacagttggaaatatgtaatttggattagctctgagaaaatcttcagctataattttacggtactccaatatgacttcttcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18930413 |
tcatagtcttcataccgaacagttggaaatatgtaatttggattagctctgagaaaatcttcggctataattttacggtactccaatatgacttcttcat |
18930512 |
T |
|
| Q |
117 |
tgtcttctggaaaaatgacagacaatagaggcgatgtaccaatgggcagaagttcatcaattgttgttcttctggtcactctccgagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
18930513 |
tgtcttctggaaaaatgacagacaatagaggcgatgtaccaatgggaggaagttcatcaatttcttttcttctggtcactctccgagt |
18930600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 36844721 - 36844917
Alignment:
| Q |
14 |
tcatcatagtcttcataccgaacagttggaaatatgtaatttggattagctctgagaaaatcttcagctataattttacggtactccaatatgacttctt |
113 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36844721 |
tcatcgtaatcttcataccgaacagttggagatatgtaatttggatttgctctgagaaaatcttcagctataattttacggtactccaatatgacttcct |
36844820 |
T |
|
| Q |
114 |
cattgtcttctggaaaaatgacagacaatagaggcgatgtaccaatgggcagaagttcatcaattgttgttcttctggtcactctccgagtataatc |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
36844821 |
cactgtcttctggaaaaatgacagacaatagaggcgatgtaccaataggtggaagttcaccaattgctgttcttctggtcactttccgagtagaatc |
36844917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University