View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19085_high_13 (Length: 329)
Name: NF19085_high_13
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19085_high_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 4676805 - 4677136
Alignment:
| Q |
1 |
tgttcatgtgagggtacctcagttagtacccgtctatttactagtatctatagcaaggatataagactttaattaaaaaactagttaagtttcatgataa |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676805 |
tgttcatgtgagggtaactcagttagtacccgtctatccactagtatctatagcaaggatataagactttaattaaaaaactagttaagtttcatgataa |
4676904 |
T |
|
| Q |
101 |
taagaacaatatcttaatagaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatattctcttttctttgcactttcc |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4676905 |
taagaacaatatcttaataaaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatgttctcttttctttgcactttcc |
4677004 |
T |
|
| Q |
201 |
tttacccttcccttgttttcattatttcttgttgtgacctat---ttatatatttccatcgctacagcctacatgtaccatttcaccgctcgagtattgt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4677005 |
tttacccttcccttgttttcattatttcttggtgtgacctatttattatatatttccatcgctacagcctacatgtaccatttcaccgctcgagtattgt |
4677104 |
T |
|
| Q |
298 |
ttttgcccaataactaaggtatgtatcccatc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4677105 |
ttttgcccaataactaaggtatgtatcccatc |
4677136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University