View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19085_high_24 (Length: 266)

Name: NF19085_high_24
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19085_high_24
NF19085_high_24
[»] chr2 (1 HSPs)
chr2 (19-256)||(14212106-14212343)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 14212343 - 14212106
Alignment:
19 cttgattcaagcagattcacaaaagatgttgttgctttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14212343 cttgattcaagcagattcacaaaagatgttgttgctttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttat 14212244  T
119 taatcgaagaagcattgcagccactagaattctatctctttgatcatgcaagcagaaatcatagactcggccnnnnnnnccgcgaagaaagttctaagat 218  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||       |||||||||||||||||||||    
14212243 taatcgaagaagcattgcagccactagaattccatctctttgatcatgcaagcagaaatcataaactcggcccgaaaaaccgcgaagaaagttctaagat 14212144  T
219 gaaattgcaaacattagaaaaatgtggtgaagagtata 256  Q
    ||||||||||||||||||||||||||||||||||||||    
14212143 gaaattgcaaacattagaaaaatgtggtgaagagtata 14212106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University