View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19085_high_29 (Length: 250)
Name: NF19085_high_29
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19085_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 38820119 - 38819900
Alignment:
| Q |
1 |
acatgtatgcgcattcatgtgacaaacaattggatattcagctataacannnnnnnnnnnnacgtaggggatgaatttactctataaggaatttactttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38820119 |
acatgtatgcgcattcatgtgacaaacaattggatattcggctataacattttttgtttttacgtagggaatgaatttactctataaggaatttactttc |
38820020 |
T |
 |
| Q |
101 |
aggagttatatataaacgagggtgtgaggttcgtggtggtgacagttagttttttattcgtgtgcccttaaacctttggaaaaaatatttgtattaaata |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820019 |
gggagttatatttaaacgagggtgtgaggtccgtggtggtgacagttagttttttattcgtgtgcccttaaacctttggaaaaaatatttgtattaaata |
38819920 |
T |
 |
| Q |
201 |
tatttcagaagaatgtttaa |
220 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
38819919 |
tatttcagaataatgtttaa |
38819900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University