View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19085_high_30 (Length: 248)
Name: NF19085_high_30
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19085_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 92 - 232
Target Start/End: Complemental strand, 53214118 - 53213978
Alignment:
| Q |
92 |
tgctcaatgtcctaatgaatggtagttgcttttccatgtgttttgaggaagcgggaagagtggtttttctaaagacgcaacttctgattatgttacacca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53214118 |
tgctcaatgtcctaatgaatggtagttgcttttccatgtgttttgaggaagcgggaagagtggtttttctaaagacacaacttctgattatgttacacca |
53214019 |
T |
 |
| Q |
192 |
tcatcctcccaacgacaaggttttcaaacaggtttacataa |
232 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53214018 |
tcatcctccctacgacaaggttttcaaacaggtttacataa |
53213978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 87 - 232
Target Start/End: Original strand, 45476656 - 45476801
Alignment:
| Q |
87 |
tttattgctcaatgtcctaatgaatggtagttgcttttccatgtgttttgaggaagcgggaagagtggtttttctaaagacgcaacttctgattatgtta |
186 |
Q |
| |
|
||||||||||||| | | | |||||||||||||||||||||||| |||||||||| || | |||| |||||||||||||| ||||||||||| | ||| |
|
|
| T |
45476656 |
tttattgctcaatattccagtgaatggtagttgcttttccatgtattttgaggaaccgcgtcgagtagtttttctaaagacacaacttctgatggtatta |
45476755 |
T |
 |
| Q |
187 |
caccatcatcctccc-aacgacaaggttttcaaacaggtttacataa |
232 |
Q |
| |
|
||||||| ||||||| | || || |||||||||||||||||||||| |
|
|
| T |
45476756 |
caccatcctcctccctgaaga-aaagttttcaaacaggtttacataa |
45476801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University