View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19085_high_5 (Length: 444)
Name: NF19085_high_5
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19085_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 18 - 435
Target Start/End: Complemental strand, 37495194 - 37494778
Alignment:
| Q |
18 |
atatgaatatggattatattctccacaagttgaaataaaacctagacgtacgggtcttggtgctgtattcaagtattatattagatttctttttgttcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495194 |
atatgaatatggattatattctccacaagttgaaataaaacctagacgtacgggtcttggtgctgtattcaagtattatattagatttctttttgttcgt |
37495095 |
T |
 |
| Q |
118 |
tttccaccataaatatatggtctagtttcaattagatcttatattattggttcaagataacttctagctatgctgcatatatattactatatcctaatct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495094 |
tttccaccataaatatatggtctagtttcaattagatcttatataattggttcaagataacttctagctatgctgcatatatattactatatcctaatct |
37494995 |
T |
 |
| Q |
218 |
ctttttgtttgactgctttactagcagtactataattttatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagataa |
317 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494994 |
ctttttttttgactgc-ttactagtagtactataattttatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagataa |
37494896 |
T |
 |
| Q |
318 |
ttaccacaagttgaatgtcccttttgtatgttttacagtgggtcatattgatggcaatattaacgtttattcttacactgctgctggattgcatctagga |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494895 |
ttaccacaagttgaatgtcccttttgtatgttttacagtgggtcatattgatggcaacattaacgtttattcttacactgctgctggattgcatctagga |
37494796 |
T |
 |
| Q |
418 |
ggactcgtctgtgctgct |
435 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
37494795 |
ggactcgtgtgtgctgct |
37494778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University