View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19085_high_7 (Length: 395)
Name: NF19085_high_7
Description: NF19085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19085_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 16738734 - 16738382
Alignment:
| Q |
1 |
aaacctacgctccaagtgaaacttgtgctagaaatttgattatggcaagccaattgaaggtctctccaagaaccatccgatagaaaagggtataaaccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
16738734 |
aaacctacgctccaagtgaaacttgtgctagaaatttgattatggcaagccaattgaaggtctctccaagaaacatctaatagaaaagagtataaaccac |
16738635 |
T |
|
| Q |
101 |
aatagccaccctggacaagaacaaagattaagctttctagaagaccaaataaaaaacatctaaaagaaccatcgcatgcagaaatagtcactcattataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16738634 |
aatagccaccctggacaagaacaaagattaagctttctagaagaccaaataaaaaacatctaaaagaaccatcacatgcagaaatagtcactcattataa |
16738535 |
T |
|
| Q |
201 |
atgatcaaggctttaagctacttcctacaacctaaatttaatagcaaatttggtaattcatttgaagggaagaacgttggtgaaaacaagagtcaaggga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738534 |
atgatcaaggctttaagctacttcctacaacctaaatttaatagcaaatttggtaa-tcatctgaagggaagaacgttggtgaaaacaagagtcaaggg- |
16738437 |
T |
|
| Q |
301 |
tctaaacaaagtacccatcattcatcacggattccccttcaattattgtgcttaa |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738436 |
tctaaacaaagtacccatcattcatcacggattccccttcaattattgtgcttaa |
16738382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University