View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19086_high_7 (Length: 251)
Name: NF19086_high_7
Description: NF19086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19086_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 60 - 243
Target Start/End: Complemental strand, 50243373 - 50243190
Alignment:
| Q |
60 |
gaaattcacatagtatttcgttgtctgtcacaacaataataataagtaacaactatatcgccccgacacttgagattgaaagcatgttcaatgtctaaca |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50243373 |
gaaattcacatagtatttcgttgtctgtcacaacaataataataagtaacaactatatcggcccgacacttgagattgaaaacatgttcaatgtctaaca |
50243274 |
T |
|
| Q |
160 |
tgtgtaggtgtatgtgacattggcacaacaccgacatagtcattttatattggtagttgaatagaatagattcctacctatgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243273 |
tgtgtaggtgtatgtgacattggcacaacaccgacatagtcattttatattggtagttgaatagaatagattcctacctatgct |
50243190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 160
Target Start/End: Original strand, 3963719 - 3963755
Alignment:
| Q |
124 |
gacacttgagattgaaagcatgttcaatgtctaacat |
160 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3963719 |
gacactttagattgaaggcatgttcaatgtctaacat |
3963755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University