View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19087_high_8 (Length: 249)
Name: NF19087_high_8
Description: NF19087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19087_high_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 44198698 - 44198928
Alignment:
| Q |
16 |
atcaacacctgaggaggaaaataaatttgagnnnnnnncaacacatttaatttctctccatttttgggttaagggtaagggcatcattgtcaccatgtac |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44198698 |
atcagcacctgaggaggaaaataaatttgagaaaaaaacaacacatttaatttctctctatttttgggttaagggtaagggcatcattgtcaccatgtac |
44198797 |
T |
 |
| Q |
116 |
cccatcacctctatatatactcactttcccacaatcatgtttctcacttcatctttataaatctttctaagtttcttctatatggtactatgttttattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44198798 |
cccatcacctctatatatactcactttcccacaatcatgtttctcacttcatctttataaatctttctaagt---ttctatatggtactatgttttattg |
44198894 |
T |
 |
| Q |
216 |
caaagtaccaacaacaccatattcctagttagta |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44198895 |
caaagtaccaacaacaccatattcctagttagta |
44198928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University