View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19087_low_13 (Length: 237)
Name: NF19087_low_13
Description: NF19087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19087_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 29417182 - 29417404
Alignment:
| Q |
3 |
gacttcaaactccaaaggaacaaccgaagtaccatctccgtattgccgtttttaaggaagagagatccggttcgctgtagcaccattaatttcactttgt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29417182 |
gacttcaaactccaaaggaacaaccgaagtaccatctccgtattgccgtttttaaggaagagagatcaggttcgctgtagcaccattaatttcactttgt |
29417281 |
T |
 |
| Q |
103 |
tactcacgaatttgttattcgtagcccttttctcattaaaaattatatttatattttctattgcagggttttagcaacaatgtatcttcagtgttacata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29417282 |
tactcacgaatttgttattcgtagcccttttctcattaaaaattatatttatattttctattgcagggttttagcaacaatgtatcttcagtgttacata |
29417381 |
T |
 |
| Q |
203 |
aatgacaatggtgacaaagttta |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29417382 |
aatgacaatggtgacaaagttta |
29417404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University